View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5432_high_6 (Length: 211)
Name: NF5432_high_6
Description: NF5432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5432_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 34797124 - 34797305
Alignment:
| Q |
13 |
agcaaaggatttttggtcggctgagacttatgatgtaaagcttccttggaaggacttggctgtaggccgtgtttgtcatggacgtggtcgtgggtgggat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34797124 |
agcaaaggatttttggtcggctgagacttatgatgtaaagcttccttggaaggacttggctgtaggccgtgtttgtcatggacgtggtcgtgggtgggat |
34797223 |
T |
|
| Q |
113 |
tccctaagaagaaatgaaagcatgcctgaacatctggtggacgcgtgtaagaggtgtgctcgagcatttataagggctgaat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34797224 |
tccctaagaagaaatgaaagcatgcctgaacatctagtggacgcgtgtaagaggtgtgctcgagcatttataagggccgaat |
34797305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University