View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5432_low_6 (Length: 211)

Name: NF5432_low_6
Description: NF5432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5432_low_6
NF5432_low_6
[»] chr6 (1 HSPs)
chr6 (13-194)||(34797124-34797305)


Alignment Details
Target: chr6 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 34797124 - 34797305
Alignment:
13 agcaaaggatttttggtcggctgagacttatgatgtaaagcttccttggaaggacttggctgtaggccgtgtttgtcatggacgtggtcgtgggtgggat 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34797124 agcaaaggatttttggtcggctgagacttatgatgtaaagcttccttggaaggacttggctgtaggccgtgtttgtcatggacgtggtcgtgggtgggat 34797223  T
113 tccctaagaagaaatgaaagcatgcctgaacatctggtggacgcgtgtaagaggtgtgctcgagcatttataagggctgaat 194  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||    
34797224 tccctaagaagaaatgaaagcatgcctgaacatctagtggacgcgtgtaagaggtgtgctcgagcatttataagggccgaat 34797305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University