View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5434_high_16 (Length: 244)
Name: NF5434_high_16
Description: NF5434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5434_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 26 - 243
Target Start/End: Complemental strand, 44733091 - 44732879
Alignment:
| Q |
26 |
gtagcttaatttgtaaggctaatgacatgcctttctaattttagacacaaaccaagttcttcttggttgtttagggtgatcaaagtctctcttattttga |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44733091 |
gtagcttaatttgtaaggctaatgacatgcctttctaattttagacacaaaccaagttcttcttggttgtttagggtgatcaaagtctctcttattttga |
44732992 |
T |
 |
| Q |
126 |
atttatcatgtaaatagtgccacttagctttacccttcttgcaggttgtttaagttttgaatgaaaagtgattaatcagtagaagcgagttgatagtttt |
225 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44732991 |
atttatcatgtaaatagtgcca-----ctttactcttcttgcaggttgtttaactttttaatgaaaagtgattaatcagtagaagcgagttgatagtttt |
44732897 |
T |
 |
| Q |
226 |
gtgttcactgttcatatc |
243 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44732896 |
gtgttcactgttcatatc |
44732879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University