View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5434_low_10 (Length: 347)
Name: NF5434_low_10
Description: NF5434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5434_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 34 - 328
Target Start/End: Complemental strand, 38747948 - 38747651
Alignment:
| Q |
34 |
ataattctccaacttcaacactttttggtatgtctcatttttcttcacctccggcatcaccacctatgtctccgatgaagccacgaaacggtgtttcatc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747948 |
ataattctccaacttcaacactttttggtatgtctcatttttcttcacctccggcatcaccacctatgtctccgatgaagccacgaaacggtgtttcatc |
38747849 |
T |
 |
| Q |
134 |
gctttcacgctatggttcttcgattaatagtaacaatcttcgttatagagacatgcttattgatcttttgggttcttttgaagggatgaatttcaatgac |
233 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747848 |
gctttcacgctacggttcttcaattaatagtaacaatcttcgttatagagacatgcttattgatcttttgggttcttttgaagggatgaatttcaatgac |
38747749 |
T |
 |
| Q |
234 |
ggttca---nnnnnnnnnnnnnnnnnacctgtttctgtttctgctgctaaagcacttcagatacaaaacatgggttatcttgaatctcttgatgttcc |
328 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747748 |
ggttcatcttctgcttcttcttcttcacctgtttctgtttctgctgctaaagcacttcagatacaaaacatgggttatcttgaatctcttgatgttcc |
38747651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University