View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5435-Insertion-10 (Length: 257)
Name: NF5435-Insertion-10
Description: NF5435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5435-Insertion-10 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 127 - 257
Target Start/End: Complemental strand, 46649090 - 46648961
Alignment:
| Q |
127 |
atcctgaaccttcaaccgcgaaaaactgccatttctgtcaggataaccgatcagaaagaacaaccggttaaatttgtaaatttctgaggaatacattact |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
46649090 |
atcctgaaccttcaaccgcgaaaaactgccatttctgacaggataaccaatcagaaagaacaactg-ttaaatttgtaaatttctgaggaatacattact |
46648992 |
T |
|
| Q |
227 |
cgagaacgtttgggcgcgatgataaccaatc |
257 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |
|
|
| T |
46648991 |
agagaacgtttgggcgcaatgataaccaatc |
46648961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 23 - 129
Target Start/End: Complemental strand, 46651164 - 46651057
Alignment:
| Q |
23 |
tctgcacctaatgacgatgaagtggtcattctgaccaaagaaaaatatgaatggttgttgcagagg-ttgaccaggctgataagcttgaagggaagattt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46651164 |
tctgcacctaatgacgatgaagtggtcattatgaccaaagaaaaatatgaatggttgttgcagaggcttgaccaggctgataagcttgaagggaagattt |
46651065 |
T |
|
| Q |
122 |
tacaaatc |
129 |
Q |
| |
|
|||||||| |
|
|
| T |
46651064 |
tacaaatc |
46651057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University