View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5435_low_7 (Length: 247)
Name: NF5435_low_7
Description: NF5435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5435_low_7 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 122 - 247
Target Start/End: Complemental strand, 17176363 - 17176238
Alignment:
| Q |
122 |
gtaatgtgtcattgtatagaggaaccaaatctcattgtttatgggagatactcaagaggataaaacagaatgattaatctatagttaatcaaaacttaac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17176363 |
gtaatgtgtcattgtatagaggaaccaaatctcattgtttatgggagatactcaaaaggataaaacagaatgattaacctatagttaatcaaaacttaac |
17176264 |
T |
|
| Q |
222 |
agctgagtttgtactaatatatagac |
247 |
Q |
| |
|
||||||||||||||||| |||||||| |
|
|
| T |
17176263 |
agctgagtttgtactaagatatagac |
17176238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 58
Target Start/End: Complemental strand, 17176456 - 17176417
Alignment:
| Q |
19 |
gagaacatgtgactctttgaaatttcagtatgcaatttat |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17176456 |
gagaacatgtgactctttgaaatttcagtaagcaatttat |
17176417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University