View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5436_high_5 (Length: 244)
Name: NF5436_high_5
Description: NF5436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5436_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 232
Target Start/End: Complemental strand, 40127493 - 40127281
Alignment:
| Q |
20 |
cgattagcccaagtcgtggatcagatccggaatgtgatagaggccaatgaaggaaagggagagaaagatatgaggagtgtggtgttaaaaagctctacca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40127493 |
cgattagcccaagtcgtggatcagatccggaatgtgatagaggccaatgaaggaaagggagataaagatatgaggagtgtggtgttaaaaagctccacca |
40127394 |
T |
 |
| Q |
120 |
ccgggcacagtcataccgaacggaggctccaccagatgatgtacgcagccggtgactacgagagttgtcatgcctgccacggggataatgacagtgagca |
219 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40127393 |
ccgggcacagtcatactgaacggaggctccaccagatgatgtacgcagccagtgactacgagagttgtcatgcctgccacggggataatgacagtgagca |
40127294 |
T |
 |
| Q |
220 |
caaaaggcagtat |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40127293 |
caaaaggcagtat |
40127281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University