View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5436_low_2 (Length: 451)
Name: NF5436_low_2
Description: NF5436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5436_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 59 - 383
Target Start/End: Original strand, 43015792 - 43016116
Alignment:
| Q |
59 |
cctctaatttttattggtaatttaaatttcaataaagcatagcatttgattggaacatggatatataggcacgttaatttctaaagaaatgaacgtgatg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015792 |
cctctaatttttattggtaatttaaatttcaataaagcatagcatttgattggaacatggatgtataggcacgttaatttctaaagaaatgaacgtgatg |
43015891 |
T |
|
| Q |
159 |
tttcactagcagctatacattattaactttataattatatgaaatttcaacgttcggttggtaagtatacgcttttgcacaaaaagatgaaagaacatgc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015892 |
tttcactagcagctatacattattaactttataattatatgaaatttcaacgttcggttggtaagtatacgcttttgcacaaaaagatgaaagaacatgc |
43015991 |
T |
|
| Q |
259 |
atgaaattaagggttaaggaatgtgtagatcgagtgttgacatgattaataaacattgcttgcatacaccgaaaaattaaatttgtatggacctgaccgg |
358 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43015992 |
atgaaattaagggttaaggaatgtgtatatcgagtgttgacatgattaataaacattgcttgcatacaccgcaaaattaaatttgtatggacctgaccgg |
43016091 |
T |
|
| Q |
359 |
atgataaatcagtgtcagtagctag |
383 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43016092 |
atgataaatcagtgtcagtagctag |
43016116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University