View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5436_low_3 (Length: 267)
Name: NF5436_low_3
Description: NF5436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5436_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 5247393 - 5247632
Alignment:
| Q |
10 |
aagaatatgaaatttagctgacccaatcaacacctgtctgtggtcaccctgaaaacagaattcaactcacaatcagtactttcatcaatattttcatgcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5247393 |
aagaatatgaaatttagctgacccaatcaacacctgtctgtggtcaccctgaaaacagaattcaactcacaatcagtactttcatcaatattttcatgcc |
5247492 |
T |
|
| Q |
110 |
ttcgataaaatacacacatttatgattcatatatgcttgcttgcaagctaataaatcacattaagcagttttaggaaaagtgcacgacggcataagcaat |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5247493 |
ttcgataaa-tacacacatttatgattcatatatgcttgcttgcaagctaataaatcacattaagcagttttaggaaaagtgcatgacggcataagcaat |
5247591 |
T |
|
| Q |
210 |
gcagaaatgctatacattgatgggtgcatactttttgaatg |
250 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5247592 |
gcagaaatgctatacattaatgggtgcatactttttgaatg |
5247632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University