View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5438_high_17 (Length: 304)
Name: NF5438_high_17
Description: NF5438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5438_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 17 - 288
Target Start/End: Original strand, 6260154 - 6260425
Alignment:
| Q |
17 |
atatatgggtggccgtttctggtttgagcttgagcctgagaattagttagtaatttgtatcagtgttcggtttaagacgctgtcgtgcaaggtatcacga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6260154 |
atatatgggtggccgtttctggtttgagcttgagcctgagaattagttagtaatttgtatcagtgttcggtttaagacgctgtcgtgcaaggtatcgcga |
6260253 |
T |
 |
| Q |
117 |
ttctgtatttgttaattcaacagtatcagtgctgttttatcagttaaggttgcagattttggcagagtagtttatggtagcttcttcatgtgaaccttca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6260254 |
ttctgtatttgttaattcaacagtatcagtgctgttttatcagttaaggttgcagattttggcagagtagtttatggtagcttcttcatgtgaaccttca |
6260353 |
T |
 |
| Q |
217 |
agcaattttccttctgttgtttgagtttcctggtatcagtccccaggttttggtgctgtatggatttattct |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6260354 |
agcaattttccttctgttgtttgagtttcctggtatcagtccccaggttttggtgctgtatggatttattct |
6260425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University