View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5438_high_19 (Length: 276)
Name: NF5438_high_19
Description: NF5438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5438_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 261
Target Start/End: Original strand, 521112 - 521353
Alignment:
| Q |
20 |
gaaaggtatacccaaagggtttatgtgttttgagtgggattcaaagctcatgaaacatagagtaaacaaatgagagcttgatgaaatattatatcttgtc |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
521112 |
gaaaggtatacccaaagggtttatatgttttgggtgggattcaaagctcatgaaacatagagtaaacaaatgagagcttgatgaaatattatatcttgtc |
521211 |
T |
 |
| Q |
120 |
attcattttatctctttgtagtgactcattgataatggattagagagagatctttcccctaagtatatatcattgttgggccgaacctagaaaccaaatc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
521212 |
attcattttatctctttgtagtgactcattgataatggattagagagagatctttcccctaaatatatgtcattgttgggccgaacctagaaaccaaatc |
521311 |
T |
 |
| Q |
220 |
ttggtgtatttcttcctctactctctctatgtttgtcctttg |
261 |
Q |
| |
|
|| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
521312 |
ttagtgtatttcttcctctactctctctatctttgtcctttg |
521353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University