View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5438_low_29 (Length: 204)
Name: NF5438_low_29
Description: NF5438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5438_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 48 - 186
Target Start/End: Complemental strand, 30116792 - 30116657
Alignment:
| Q |
48 |
atggatgaagcttgtttcaagggtaggatggtggggccaaagtgaattcaattcattattaacctttatgtgtaggatgcagccaaagtgaatttaattc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30116792 |
atggatgaagcttgtttcaagggtaggatggtggggccaaagtgaattcaattcatta---acctttatgtgtaggatgcagccaaagtgaatttaattc |
30116696 |
T |
 |
| Q |
148 |
attttacctttattttgttaaaaacccatccttctagta |
186 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30116695 |
atttcacctttattttgttaaaaacccatccttctagta |
30116657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University