View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5439_high_5 (Length: 342)
Name: NF5439_high_5
Description: NF5439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5439_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 10 - 93
Target Start/End: Original strand, 55694289 - 55694372
Alignment:
| Q |
10 |
attattctgggtacattgatctctttaatttctgtcagtgacatgaggtgtctgcttgaaaaagattcttccaagtggccacag |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55694289 |
attattttgggtacattgatctctttaatttctgtcagtgacatgaggtgtctgcttgaaaaagattcttccaagtggccacag |
55694372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 187 - 254
Target Start/End: Original strand, 55694483 - 55694549
Alignment:
| Q |
187 |
atttcttttgtaattcatctttccattcccaaatggccactgttgaggtaattcaaagatatagtctc |
254 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55694483 |
atttcttttgtaattcctctttccattcc-aaatggccactgttgaggtaattcaaagatatagtctc |
55694549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University