View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5439_high_9 (Length: 250)
Name: NF5439_high_9
Description: NF5439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5439_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 89 - 240
Target Start/End: Complemental strand, 12834719 - 12834567
Alignment:
| Q |
89 |
gtaacatttagaaggactaataatttatttaacccaatttaaaaaa-ccattttcatttgtcgtttgttaggccagccacttttgcataaacaagcttca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12834719 |
gtaacatttagaaggactaataatttatttaacccaattaaaaaaaaccattttcatttgtcgtttgttaggccagccatttttgcataaacaagcttca |
12834620 |
T |
|
| Q |
188 |
gagaggtgacaatccaccacttgcatgtgtgtgcatatatatctgtgtctgtg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12834619 |
gagaggtgacaatccaccacttgcatgtgtgtgcatatatatctgtgtctgtg |
12834567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University