View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5439_low_10 (Length: 245)
Name: NF5439_low_10
Description: NF5439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5439_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 228
Target Start/End: Original strand, 30626802 - 30627019
Alignment:
| Q |
11 |
ttgctactagttaattaataagcacgtaattgacctttgtacattttgttttggtcatacataacgggctcatttcatactgaagttaattataagtgtg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30626802 |
ttgctactagttaattaataagcacgtaattgacctttgtacattttgttttggtcatacataacgggctcatttcatactgaagttaattataagtgtg |
30626901 |
T |
 |
| Q |
111 |
ctaacaaggtcaaaacatagagggacacatgaggtaggaactaggaagggagtgaattgtttagtagagagttgtggtgaggattgataaagatttatct |
210 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30626902 |
ctaacaaggtcaaaacatagagggaaacatgaggtaggaactaggaagggagtgaattgtttagtagagagttggggtgaggattgataaagatttatct |
30627001 |
T |
 |
| Q |
211 |
cgaagggtgtaattcaat |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30627002 |
cgaagggtgtaattcaat |
30627019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University