View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5439_low_14 (Length: 215)
Name: NF5439_low_14
Description: NF5439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5439_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 10 - 198
Target Start/End: Complemental strand, 47920263 - 47920075
Alignment:
| Q |
10 |
agtagcataggggatgaccatttgacaatatatagatcagcaaactcgtcgtcaacatcatcaccgcaagattttgaagtcaaggtgaatgatatttcaa |
109 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
47920263 |
agtatcataagggatgaccatttgacaatatatagatcagcaaactcgtcgtcaacatcatcaccgccagattttgaagtcaaggtgaatgagatttcaa |
47920164 |
T |
 |
| Q |
110 |
cgcctgcaatgactttgagtaaaccttgaagcacggcagctagatgttttctccaccattcttccagctcaattcctgaccacttaatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47920163 |
cgcctgcaatgactttgagtaaaccttgaagcacggcagctagatgttttctccaccattcttccagctcaattcctgaccacttaatt |
47920075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 15 - 156
Target Start/End: Original strand, 29916852 - 29916993
Alignment:
| Q |
15 |
cataggggatgaccatttgacaatatatagatcagcaaactcgtcgtcaacatcatcaccgcaagattttgaagtcaaggtgaatgatatttcaacgcct |
114 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
29916852 |
cataagggatgaccatttgacaatatacagatcagcatactcgtcgtcaacatcatcaccgccagattttgaagtcaatgtgaatgagatttcaatgcct |
29916951 |
T |
 |
| Q |
115 |
gcaatgactttgagtaaaccttgaagcacggcagctagatgt |
156 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29916952 |
gcaacaactttgagtaaaccttgaagcacggcagctagatgt |
29916993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 198
Target Start/End: Original strand, 29917027 - 29917068
Alignment:
| Q |
157 |
tttctccaccattcttccagctcaattcctgaccacttaatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29917027 |
tttctccaccattcttccagctcaattcctgaccacttaatt |
29917068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University