View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5440-Insertion-1 (Length: 120)
Name: NF5440-Insertion-1
Description: NF5440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5440-Insertion-1 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 3e-33; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 3e-33
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 24898733 - 24898625
Alignment:
| Q |
8 |
gaaaaattatttggactttgaaatgttttagttttttgatggagagttgagaaaaagaatgaatgaatgaatatgagagaagggtggtggtattgttgtt |
107 |
Q |
| |
|
|||||||| ||||||| |||||||| ||| | |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24898733 |
gaaaaattgtttggacgttgaaatgcttttgctttttggtggagagttgagaaaaagaatgaatgaat----atgagagaagggtggtggtattgttgtt |
24898638 |
T |
|
| Q |
108 |
atttatagtgtat |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24898637 |
atttatagtgtat |
24898625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 3e-27
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 24891234 - 24891339
Alignment:
| Q |
8 |
gaaaaattatttggactttgaaatgttttagttttttgatggagagttgagaaaaagaatgaatgaatgaatatgagagaagggtggtggtattgttgtt |
107 |
Q |
| |
|
|||||||| |||||||||||||||||| | | |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24891234 |
gaaaaattgtttggactttgaaatgttattgctttttggtggagagttgagaaaaa----gaatgaatgaatatgagagaagggtggtggta---ttgtt |
24891326 |
T |
|
| Q |
108 |
atttatagtgtat |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24891327 |
atttatagtgtat |
24891339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 61
Target Start/End: Complemental strand, 24906192 - 24906139
Alignment:
| Q |
8 |
gaaaaattatttggactttgaaatgttttagttttttgatggagagttgagaaa |
61 |
Q |
| |
|
|||||||| |||||||||||||||||| | | |||||| ||||||||||||||| |
|
|
| T |
24906192 |
gaaaaattgtttggactttgaaatgttattgctttttggtggagagttgagaaa |
24906139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University