View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5440-Insertion-8 (Length: 146)
Name: NF5440-Insertion-8
Description: NF5440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5440-Insertion-8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 142
Target Start/End: Original strand, 40306171 - 40306308
Alignment:
| Q |
8 |
ctaagcgtattactgacaatacctccttcaataaataattagtaagaaacaaacttataattagaactcaaacaaaatttatgtttatgaaaactataaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40306171 |
ctaagcgtattactgacaatacctccttcaataaataattagtaggaaacaaacttataattagaactcaaacaaaatttatgtttgtgaaaactataaa |
40306270 |
T |
 |
| Q |
108 |
tttttagagataaaaatgaagc---atgattattaatt |
142 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
40306271 |
tgtttagagataaaaatgaagcagtatgattattaatt |
40306308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University