View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5441_high_1 (Length: 270)
Name: NF5441_high_1
Description: NF5441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5441_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 25273483 - 25273221
Alignment:
| Q |
1 |
aaaggtggtgggatggtggaagtgtttgtcagcggttagtttaaagttaaaacgacgacggtgtggagagcgaggtcgccagagtggatagcaagagaga |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25273483 |
aaaggtgatgggatggtggaagtgtttgtcagcggtaagtttaaagttaaaacgacgatggcgtggagagcgaggtcgccagagtggatagcaagagaga |
25273384 |
T |
 |
| Q |
101 |
atgatttgctaatggtggaagttgcgatgttggatcagtgtgtggttgcagtgatgctgtagctagctcctacttcttctcctatcttannnnnnnatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25273383 |
atgatttgctaatggtggaagttgcgatgttggatcagtgtgtggttgcagtgatgctgtagctagctcctacttcttctcctatcttatttttttatga |
25273284 |
T |
 |
| Q |
201 |
tttcctttctctctcaaacaaatatttcatatggcctttgtttttgttttgatgatgatgatg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25273283 |
tttcctttctctctcaaacaaatatttcatatggcatttgtttttgttttgatgatgatgatg |
25273221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University