View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5441_low_4 (Length: 202)
Name: NF5441_low_4
Description: NF5441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5441_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 35 - 184
Target Start/End: Complemental strand, 6353629 - 6353479
Alignment:
| Q |
35 |
tataaataaaagaagaaaattgtttt-attagaatggaaaatttaacttttgtgataaacaaataggcattataaaaagattcattcaaacataaaaaac |
133 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6353629 |
tataaacaaaagaagaaaattgtttttattagaatggcaaatttaacttttgtgataaacaaataggcattataaaaagattcattcaaacataaaaaac |
6353530 |
T |
|
| Q |
134 |
acatggattagctgcttgataaatggtttaaatataagtatactaggtagt |
184 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6353529 |
acatggattagctacttgataaatggtttaaatataagtatactaggtagt |
6353479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University