View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5442_high_26 (Length: 282)
Name: NF5442_high_26
Description: NF5442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5442_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 114 - 281
Target Start/End: Complemental strand, 55243070 - 55242903
Alignment:
| Q |
114 |
aaactcgttgtgatggatatatgtagaggtaatggcatgagagagggttttgttgtccgattcaaaccatatgtcgtggaattcatatgagatcgtcaag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55243070 |
aaactcgttgtgatggatatatgtagaggtaatggcatgagagagggttttgttgtccgattcaaaccatatgtcgtggaattcatatgagatcgccaag |
55242971 |
T |
 |
| Q |
214 |
ttgatcgcatcaacattacactttaacactcctacctgaggtttgaccccatagataagatgaaaata |
281 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55242970 |
ttgatcgcatcaacattacactttaacacacctacctgaggtttgaccccatagataagatgaaaata |
55242903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University