View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5442_high_26 (Length: 282)

Name: NF5442_high_26
Description: NF5442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5442_high_26
NF5442_high_26
[»] chr4 (1 HSPs)
chr4 (114-281)||(55242903-55243070)


Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 114 - 281
Target Start/End: Complemental strand, 55243070 - 55242903
Alignment:
114 aaactcgttgtgatggatatatgtagaggtaatggcatgagagagggttttgttgtccgattcaaaccatatgtcgtggaattcatatgagatcgtcaag 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
55243070 aaactcgttgtgatggatatatgtagaggtaatggcatgagagagggttttgttgtccgattcaaaccatatgtcgtggaattcatatgagatcgccaag 55242971  T
214 ttgatcgcatcaacattacactttaacactcctacctgaggtttgaccccatagataagatgaaaata 281  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
55242970 ttgatcgcatcaacattacactttaacacacctacctgaggtttgaccccatagataagatgaaaata 55242903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University