View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5442_high_33 (Length: 247)
Name: NF5442_high_33
Description: NF5442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5442_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 68 - 227
Target Start/End: Original strand, 16987984 - 16988143
Alignment:
| Q |
68 |
tacttatagtgatggaatttttccgtaggacaaaccaattaggttatacctacggatttgggacgtaggtatagaacctgatcaggataaaaattaaagc |
167 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16987984 |
tacttacagtgatggaatttttccgtaggacaaaccaattaggttatacctacggatttggaaagtaggtatagaacctgatcaggataaaaattaaagc |
16988083 |
T |
 |
| Q |
168 |
taatcagcttgatatactttcacactagcttgctgccttgggtatattaagcatatatat |
227 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16988084 |
taatcagctttatatactttcacactagcttgctgccttgggtatattatgcatatatat |
16988143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 163 - 214
Target Start/End: Original strand, 17017242 - 17017293
Alignment:
| Q |
163 |
aaagctaatcagcttgatatactttcacactagcttgctgccttgggtatat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
17017242 |
aaagctaatcagcttgatatactttcacactagcttgcttccttggctatat |
17017293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 44
Target Start/End: Original strand, 16986749 - 16986781
Alignment:
| Q |
12 |
atgaatccaaaacctttgagcattcaccttcta |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16986749 |
atgaatccaaaacctttgagcattcaccttcta |
16986781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University