View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5442_high_39 (Length: 235)

Name: NF5442_high_39
Description: NF5442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5442_high_39
NF5442_high_39
[»] chr4 (1 HSPs)
chr4 (1-235)||(7978983-7979217)


Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 7979217 - 7978983
Alignment:
1 aacaaacaaattcatagacggataagataacaaataaattagatgcagtgttgttaattgcggactgtagaaaatagtggtttttcaacgtccactatgc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7979217 aacaaacaaattcatagacggataagataacaaataaattagatgcagtgttgttaattgcggactgtagaaaatagtggtttttcaacgtccactatgc 7979118  T
101 tacattgctatagcgctagtgaacggttcaaattctgctatgctatagcgcgctatttgtaattttgcattcaagaggaaatggattacctgctcaagta 200  Q
    ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7979117 tacattgctatagtgctagtgatcggttcaaattctgctatgctatagcgcgctatttgtaattttgcattcaagaggaaatggattacctgctcaagta 7979018  T
201 tgcaacctttgcgaagcgcaactaaacagtccagt 235  Q
    |||||||||||||||||||||||||||||||||||    
7979017 tgcaacctttgcgaagcgcaactaaacagtccagt 7978983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University