View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5442_high_40 (Length: 223)
Name: NF5442_high_40
Description: NF5442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5442_high_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 4673350 - 4673162
Alignment:
| Q |
17 |
atatctaacaggtactgatcgtccattatggttccccggagcaaagtcaccggagtggctagacggaagtttggtcggagattacggatttgatccattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4673350 |
atatctaacaggtactgatcgtccattatggttccccggagcaaagtcaccggagtggctagacggaagtttggtcggagattacggatttgatccattt |
4673251 |
T |
|
| Q |
117 |
ggtttggggaaaccagcagaatatttgcaatttgatctcgactcgcttgatcagaatttggcaaagaatcttgctggagatgtgatcgg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4673250 |
ggtttggggaaaccagcagaatatttgcaatttgatctcgactcgcttgatcagaatttggcaaagaatcttgctggagatgtgatcgg |
4673162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University