View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5442_low_24 (Length: 292)
Name: NF5442_low_24
Description: NF5442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5442_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 94 - 269
Target Start/End: Original strand, 4119233 - 4119408
Alignment:
| Q |
94 |
gtataatgtttttgggtaatgtttgttcttgtggcaatggagcggggcgaggtggtgatggttcaagagaagacggttgtggtgacattttagtagaagt |
193 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4119233 |
gtataatgtttttgggtaatgtatgttcttgtggcaatggagcggggcgaggtggtgatggttcaagagaagacgtttgtggtgacattttagtagaagt |
4119332 |
T |
|
| Q |
194 |
ctccagtgatgaactttgtggtgacgtttcatgagatatgatgaattgggaacatactgatcatcatagtctagaa |
269 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4119333 |
ctccggtgatgaactttgtggtgacgtttcaggagatatgatgaattgggaacatgctgatcatcatagtctagaa |
4119408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 84
Target Start/End: Original strand, 4116824 - 4116889
Alignment:
| Q |
19 |
aatagagctgttgagctctttgtttccatcaactacgtcatttagcatgcatattattattaatta |
84 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4116824 |
aatagagttgttgagctctttgtttccatcaactacgtcatttagcatgcgtattattattaatta |
4116889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University