View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5442_low_26 (Length: 290)
Name: NF5442_low_26
Description: NF5442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5442_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 7432216 - 7432497
Alignment:
| Q |
1 |
ttagagatttagttgttctatagtcgcaaaagtgtgcatta---tttgtcaaactacatgaacaaagtatgtgtctatgtgtcttgcgatattcttttat |
97 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7432216 |
ttagagatttagttgttttatagtcgcaaaagtgtacattactatttgtcaaactacatgaa---agtatgtgtctatgtgtcttgcgatattcttttat |
7432312 |
T |
 |
| Q |
98 |
tttatttttctatcgttcgttggtgttctaatacaatcattcgactatttagacttcgtttgaccttaattggttggtggtttattttcaactaattgta |
197 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
7432313 |
tttatttttttatcgtttgttggtgttctaatacaatcattcgactatttagacttcatttgaccttaattgattggtggtttattttcaactaagtgta |
7432412 |
T |
 |
| Q |
198 |
acatatgtaatcttttttcatagctaatatttttattagatttgcttcttgttccaaattattgatccttttttctcttcttctc |
282 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7432413 |
acatatgtaatcttttttcatagttaatctttttattagatttgcttcttgttccaaattattgaaccttttttctcttcttctc |
7432497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University