View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5442_low_31 (Length: 253)
Name: NF5442_low_31
Description: NF5442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5442_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 8e-36; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 165 - 245
Target Start/End: Original strand, 7505913 - 7505993
Alignment:
| Q |
165 |
gtaattatataagattaaatgatttttgcataggtctcgcatcttttctttgtattttggggaaaagtcaaatcctttgtt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7505913 |
gtaattatataagattaaatgatttttgcataggtctcacatcttttctttgtattttggggaaaagtcaaatcctttgtt |
7505993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 7505755 - 7505801
Alignment:
| Q |
8 |
tgtactgattgctaagcattatttgaagggtgtgtttgtttcatctt |
54 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7505755 |
tgtactgattgctaagcattatttcaagggtgtgtttgtttcatctt |
7505801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 81 - 114
Target Start/End: Original strand, 7505829 - 7505862
Alignment:
| Q |
81 |
tctagagattttttctatagattttaaccttgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7505829 |
tctagagattttttctatagattttaaccttgtg |
7505862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University