View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5442_low_36 (Length: 242)
Name: NF5442_low_36
Description: NF5442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5442_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 7505370 - 7505191
Alignment:
| Q |
1 |
aaaagaaatctagtcatcctatgctagatgttactgccaaggaaactgatgttagccttgtcaatgatgttaatcatgttgtgattaacttggaagatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7505370 |
aaaagaaatctagtcatcctatgctagatgttactgccaaggaaactgatgttagccttgtcaatgatgttaatcatgtagtgattaacttggaagatca |
7505271 |
T |
 |
| Q |
101 |
ataattagattcagaattaatgtataaagtagttgagcagaagggttgagaatttgattcaacataatcttgtgactata |
180 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7505270 |
ataattagattcagaattaatttataaagtagttgagcagaagggttgagaatttgattcaacataatcttgtgactata |
7505191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 7505168 - 7505120
Alignment:
| Q |
178 |
atataaatggtcatgctctgtccgtagcaagcatgctgaatattatttt |
226 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
7505168 |
atataaatggtcatgctctgtctgtagcaagcttgctgaatattatttt |
7505120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University