View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5442_low_46 (Length: 208)
Name: NF5442_low_46
Description: NF5442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5442_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 13 - 193
Target Start/End: Complemental strand, 1313771 - 1313592
Alignment:
| Q |
13 |
gtgagatgaatcccaaacgtgtgtttttacgtccctccctatccttggacagtttgcatgtgctcatacaacttttgccttcacaactaccgctacatan |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
1313771 |
gtgatatgaatcccaaacgtgtgtttttacgtccctccctatc-ttggacagtttgcatgtgctcatacaacttttgccttcacagccaccgctacatat |
1313673 |
T |
 |
| Q |
113 |
nnnnnnaattcctttttgtatagtattgaatatatttttcaagaatgccctctcaaagtatatagtatggaatgtaataag |
193 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1313672 |
ttttttaattcctttttctatagtattgaatatatttttcaagaatgccctctcaaagtatatagtatggaatgtaataag |
1313592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University