View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5442_low_5 (Length: 486)
Name: NF5442_low_5
Description: NF5442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5442_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 98 - 446
Target Start/End: Original strand, 7978418 - 7978766
Alignment:
| Q |
98 |
ctcttacaagggtttgaagtttggcttctgacatcagattttttgtgtcttttcagcgcttttatcattatcttgatctgaaatcaaagcatccagatgc |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7978418 |
ctcttacaagggtttgaaatttggcttctgacatcagattttttgtgtcttttcagcgcttttatcattatcttgatctgaaatcaaagcatccagatgc |
7978517 |
T |
|
| Q |
198 |
ttcagtgccacctctcgattatacactcaggaaaattacagaaactgagactgacttggttttgcagaaccaatctgtcattgactcatatcgtagatct |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7978518 |
ttcagtgccacctctcgattatacactcaggaaaattacagaacctgagactgacttggttttgcagaaccaatctgtcattgactcatatcgtagatct |
7978617 |
T |
|
| Q |
298 |
tttgagatgcagggaaatcccttggtaagaatgagtacttagttcttagtcttgaagacggtaataatttccgataagttttatatttgcactatctacc |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||| ||||||||||||||||| | ||||| | |
|
|
| T |
7978618 |
tttgagatgcagggaaatcccttggtaagaatgagtacttagttcttagtcgagtagacggtactaatttcagataagttttatatttgaaatatctcac |
7978717 |
T |
|
| Q |
398 |
agcagaaaaagccaaggcattttttgcgaggaaatacaagtgatgaaga |
446 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
7978718 |
tgcagaaaaagccaaggcgttttttgcgaggaaagacaagtgatgaaga |
7978766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University