View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5444-Insertion-6 (Length: 360)
Name: NF5444-Insertion-6
Description: NF5444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5444-Insertion-6 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 8 - 360
Target Start/End: Original strand, 41260741 - 41261093
Alignment:
| Q |
8 |
tctgaatgatcattcattattcattaatcactcatgtctagttttgtttggttcccttcatgtttccgacgagtcgggtccagactgccttatgcaacca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41260741 |
tctgaatgatcattcattattcattaatcacccatgtctagttttgtttggttcccttcatgtttccgacgagtcgggtccagactgccttatgcaacca |
41260840 |
T |
 |
| Q |
108 |
catggaccattcttttgatcgttaccgtggtgttggcgtcattggcacccggtgtggcctttatgtttgcagtatctcaatcatcaaagccttgtcatca |
207 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41260841 |
catggaccgttcttttgatcgttaccgtggtgttgacgtcgttggcacccggtgtggcctttatgtttgcagtatctcaatcatcaaagccttgtcatca |
41260940 |
T |
 |
| Q |
208 |
tcatgaatttgtgaggattccttttgattctccgacggagatggtttgcttgccggaacatgtggtggttagcacctcccactttgatttcttcttgccc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41260941 |
tcatgaatttgtgaggattccttttgattctccgacggagatggtttgcttgccggaacatgtggtggttagcacctcccactttgatttcttcttgccc |
41261040 |
T |
 |
| Q |
308 |
acgttgtttgctgctttggttgtttttacttcaacttgcttgcttcgttctgt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41261041 |
acgttgtttgctgctttggttgtttttacttcaacttgcttgcttcgttctgt |
41261093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University