View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5445_high_19 (Length: 256)

Name: NF5445_high_19
Description: NF5445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5445_high_19
NF5445_high_19
[»] chr1 (2 HSPs)
chr1 (19-256)||(44232301-44232554)
chr1 (19-60)||(44226363-44226404)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 44232301 - 44232554
Alignment:
19 cttttgagtcagaggaatgaggataaaccgatgatagttgcatgggaatcaataccacttgttgaaccaattccacaacgaatcgtttttccccacctat 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
44232301 cttttgagtcagaggaatgaggataaaccgatgatagttgcatgggaatcaataccacttgttgaaccaattccacaacgaatcgtttttccccgcctat 44232400  T
119 ttgttcttgttttttcccgccagtttcttacgaaacataaacgactaacatggtcata----------------aattgagagagaatttggcatattat 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                ||||||||||||||||||||||||||    
44232401 ttgttcttgttttttcccgccagtttcttacgaaacataaacgactaacatggtcataaataaacacaaacagtaattgagagagaatttggcatattat 44232500  T
203 tgaattcaacgagaaatttacatgtcaaaattcagttttatcaagttcaatgtc 256  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||    
44232501 tgaattcaacgagaaatttacatgtcaaaattcagttttatctagttcaatgtc 44232554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 44226363 - 44226404
Alignment:
19 cttttgagtcagaggaatgaggataaaccgatgatagttgca 60  Q
    |||||| |||||||||||||||||||||| |||| |||||||    
44226363 cttttgggtcagaggaatgaggataaacccatgagagttgca 44226404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University