View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5445_low_19 (Length: 256)
Name: NF5445_low_19
Description: NF5445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5445_low_19 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 44232301 - 44232554
Alignment:
| Q |
19 |
cttttgagtcagaggaatgaggataaaccgatgatagttgcatgggaatcaataccacttgttgaaccaattccacaacgaatcgtttttccccacctat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44232301 |
cttttgagtcagaggaatgaggataaaccgatgatagttgcatgggaatcaataccacttgttgaaccaattccacaacgaatcgtttttccccgcctat |
44232400 |
T |
 |
| Q |
119 |
ttgttcttgttttttcccgccagtttcttacgaaacataaacgactaacatggtcata----------------aattgagagagaatttggcatattat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44232401 |
ttgttcttgttttttcccgccagtttcttacgaaacataaacgactaacatggtcataaataaacacaaacagtaattgagagagaatttggcatattat |
44232500 |
T |
 |
| Q |
203 |
tgaattcaacgagaaatttacatgtcaaaattcagttttatcaagttcaatgtc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44232501 |
tgaattcaacgagaaatttacatgtcaaaattcagttttatctagttcaatgtc |
44232554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 44226363 - 44226404
Alignment:
| Q |
19 |
cttttgagtcagaggaatgaggataaaccgatgatagttgca |
60 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||| ||||||| |
|
|
| T |
44226363 |
cttttgggtcagaggaatgaggataaacccatgagagttgca |
44226404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University