View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5445_low_20 (Length: 245)
Name: NF5445_low_20
Description: NF5445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5445_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 26783083 - 26782856
Alignment:
| Q |
1 |
taagccctttcctttgaaattattttaccggtgtatatgcttttgctccatccccgaggataagtgaactaatgagctatttcatgtttaatgcagctaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26783083 |
taagccctttcctttgaaattattttaccagtgtatatgcttttgctccatccccgaggataagtgaactaatgagctatttcatgtttaatgcagctaa |
26782984 |
T |
|
| Q |
101 |
ggagtgcagttgctactcttgccagtgaaggatttgtttccatggctggtgacagtgtaaaaagaacatgatacgatgaggcagggtcatcattggtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26782983 |
ggagtgcagttgctactcttgccagtgaaggatttgtttccatggctggtgacagtgtaaaaagaacatgatacgatgaggcagggtcatcattggtttt |
26782884 |
T |
|
| Q |
201 |
aggggactgtttgatacttaagctagtt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
26782883 |
aggggactgtttgatacttaagctagtt |
26782856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University