View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5445_low_27 (Length: 204)
Name: NF5445_low_27
Description: NF5445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5445_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 43403257 - 43403428
Alignment:
| Q |
18 |
actataaaccgttttgaaccttgttttctccaaaaataccatggctttagttcaactttgcaggtatattgggcttctccttctggaccttctactgata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43403257 |
actataaaccgttttgaaccttgttttctccaaaaataccatggctttagttcaactttgcaggtatattgggcttctccttctggaccttctactgata |
43403356 |
T |
|
| Q |
118 |
ttgatagtccatgaagcaacaagtttttgcaccatgtgatggttatcaaacggcaatgatcagctacctttg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43403357 |
ttgatagtccatgaagcaacaagtttttgcaccatgtgatggttatcaaacggcaatgatcagctacctttg |
43403428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 24 - 189
Target Start/End: Original strand, 34432333 - 34432498
Alignment:
| Q |
24 |
aaccgttttgaaccttgttttctccaaaaataccatggctttagttcaactttgcaggtatattgggcttctccttctggaccttctactgatattgata |
123 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||| ||||| |||||| ||||||| | ||| ||| || ||| |||| || ||||| |
|
|
| T |
34432333 |
aaccgttttgaaccttgtttcctccaaaagtaccatggctttagctcaaccttgcagctatattgagtttccttttcagggttttccactgttactgata |
34432432 |
T |
|
| Q |
124 |
gtccatgaagcaacaagtttttgcaccatgtgatggttatcaaacggcaatgatcagctacctttg |
189 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| || ||||||||||| ||| |||||| ||||| |
|
|
| T |
34432433 |
agccatgaagcatcaagtttttgcaccatgtgattgtgatcaaacggcagtgaccagctaactttg |
34432498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University