View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5446_high_24 (Length: 269)
Name: NF5446_high_24
Description: NF5446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5446_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 17 - 130
Target Start/End: Original strand, 10609027 - 10609139
Alignment:
| Q |
17 |
ataacctaaggctagtctctatagatcacgggtagcccatttgacccacataacnnnnnnntgctaaaacaaattagtaaaatttatgaagtaaaaactt |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10609027 |
ataacccaaggctagtctctatagatcacgggtagcccatttaacccacataacaaaaaa-tgctaaaacaaattagtaaaatttatgaagtaaaaactt |
10609125 |
T |
 |
| Q |
117 |
acctttctctagtc |
130 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10609126 |
acctttctctagtc |
10609139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University