View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5446_high_32 (Length: 240)
Name: NF5446_high_32
Description: NF5446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5446_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 140 - 224
Target Start/End: Original strand, 13671949 - 13672033
Alignment:
| Q |
140 |
aaaattggcataattaataattgcgttgttgaaagtattgagttttaaatgttcatattatgccatatattacctgcattatatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13671949 |
aaaattggcataattaataattgcgttgttgaaagtattgagttttaaatgttcatattatgctatatattacctgcattatatt |
13672033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 17 - 98
Target Start/End: Original strand, 13671827 - 13671908
Alignment:
| Q |
17 |
aagatgatatgtttgtttccattctnnnnnnntagattctttcaaccatgtaagatttgacctgccatgtctcccatcatag |
98 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13671827 |
aagatgatatgtttgtttccattctgggggggtagattcattcaaccatgtaagatttgacctgccacgtctcccatcatag |
13671908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University