View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5446_low_20 (Length: 319)
Name: NF5446_low_20
Description: NF5446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5446_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 9e-98; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 5 - 226
Target Start/End: Complemental strand, 34561632 - 34561410
Alignment:
| Q |
5 |
tgtcgaagaatatcgtaccatcatcttttaagtttaatgttggaagtgcatgaaagaaaaactgtgtttttcatgcattgattgtattgactttttcttc |
104 |
Q |
| |
|
||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34561632 |
tgtcgaaatatattgtgccatcatcttttaagtttaatgttggaagtgcatgaaagaaaaactgtgtttt-catgcattgattgtattgactttttcttc |
34561534 |
T |
 |
| Q |
105 |
taatccttgtattgattggttgctagtgctggcaccatatgtttcttgatcatttcttcagtgcaccata--tataattgaaccaaaagccaagaaaatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34561533 |
taatccttgtattgattggttgctagtgctagcaccatatgtttcttgatcatttctttagtgcaccatatatataattgaaccaaaagccaagaaaatt |
34561434 |
T |
 |
| Q |
203 |
ggatttcatgatgcttaatttcta |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34561433 |
ggatttcatgatgcttaatttcta |
34561410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 255 - 302
Target Start/End: Complemental strand, 34561380 - 34561334
Alignment:
| Q |
255 |
agggcagttggggataagtggtactgtatgtatgcagtatggtgtttg |
302 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34561380 |
agggcagttggggataa-tggtactgtatgtatgcagtatggtgtttg |
34561334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 169 - 226
Target Start/End: Original strand, 34583608 - 34583665
Alignment:
| Q |
169 |
accatatataattgaaccaaaagccaagaaaattggatttcatgatgcttaatttcta |
226 |
Q |
| |
|
|||||| ||||| |||||||||||| ||||| |||||||||||| ||||| ||||||| |
|
|
| T |
34583608 |
accatagataatggaaccaaaagcctagaaagttggatttcatggtgcttgatttcta |
34583665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University