View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5446_low_28 (Length: 259)
Name: NF5446_low_28
Description: NF5446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5446_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 24 - 253
Target Start/End: Original strand, 32240399 - 32240630
Alignment:
| Q |
24 |
cactataaattttacttcatttgctggaaatttctggtttagggtatatgtggtttctgcaaaaggtaattaccatgtgtcaggaagtttgaaactattg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32240399 |
cactataaattttacttcatttgctggaaatttctggtttagggtatatgtggtttctgcaaaaggtaattaccatgtgtcaggaagtttgaaactattg |
32240498 |
T |
 |
| Q |
124 |
gcaatgggtcagagatactgatttttcccttcttttcttttaattgattctgacaatgcgtgtataaaagatgaaattcata--tgccctttttctctat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32240499 |
gcaatgggtcagagatactgatttttcccttcttttcttttaattgattctgacactgcgtgtataaaagatgaaattcatatgtgccctttttctctat |
32240598 |
T |
 |
| Q |
222 |
aaaatggtgcttgctgtgttcatttcatctca |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32240599 |
aaaatggtgcttgctgtgttcatttcatctca |
32240630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University