View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5446_low_32 (Length: 241)
Name: NF5446_low_32
Description: NF5446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5446_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 29332867 - 29332636
Alignment:
| Q |
1 |
tgatggaaagatcttggcgggggtacatcgtgaagtgttttggtgcatgattcgtgcagtggagatagaagctgcgagcgaagaggtgatgtgtgaggcg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29332867 |
tgatggaaagatctttgcgggggtacatcgtgaagtgttttggtgcatgattcgtgcagtggagatagaagctgcgagcgaagaggtgatgtgtgaggcg |
29332768 |
T |
|
| Q |
101 |
atagttgttatcaaggagtttgatacggtggatgtggagacgatggaaagtgtgattgggaatctttctctggaggaagtgaagagggtatttgcggttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29332767 |
atagttgttatcaaggagtttgatacggtggatgtggagacgatggaaagtgtgattgggaatctttctctggaggaagtgaagagggtatttgcggttg |
29332668 |
T |
|
| Q |
201 |
ctatgaagatgctgtcgtgtgttattgatgat |
232 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |
|
|
| T |
29332667 |
ctatgaagatgctatcgtgtgttattgatgat |
29332636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 161 - 232
Target Start/End: Complemental strand, 29321516 - 29321445
Alignment:
| Q |
161 |
aatctttctctggaggaagtgaagagggtatttgcggttgctatgaagatgctgtcgtgtgttattgatgat |
232 |
Q |
| |
|
|||||||||| |||||||||| |||||| || |||||||| |||| ||| |||||||||||||||||||| |
|
|
| T |
29321516 |
aatctttctcatgaggaagtgagaagggtagttacggttgctgtgaacatgttgtcgtgtgttattgatgat |
29321445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 81
Target Start/End: Complemental strand, 29304466 - 29304410
Alignment:
| Q |
25 |
acatcgtgaagtgttttggtgcatgattcgtgcagtggagatagaagctgcgagcga |
81 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | || |||| |||||| || |||||| |
|
|
| T |
29304466 |
acatggtgaagtgttttggtgcatgattcgagtagcggaggtagaagatgtgagcga |
29304410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University