View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5446_low_35 (Length: 225)
Name: NF5446_low_35
Description: NF5446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5446_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 206
Target Start/End: Original strand, 23870326 - 23870526
Alignment:
| Q |
15 |
cagagacatgattactagaactaaatgtacatggccaaagtaatatagcacttcaattacattattccttcaataagctaaggactgatatttagatcag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23870326 |
cagagacatgattactagaactaaatgtacatggccaaaataatatagcacttcaattacattattccttcgataagctaaggactgatatttagatcag |
23870425 |
T |
|
| Q |
115 |
taataaactccattacaatacccaaaggagcagctagta---------gctgctgctgctgcttgaataatacttcacaatagtcactgggcatggagag |
205 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23870426 |
taataaactccattacaatacccagaggagcagctagtagctgctgctgctgctgctgctgcttgaataatacttcacaatagtcactgggcatggagag |
23870525 |
T |
|
| Q |
206 |
t |
206 |
Q |
| |
|
| |
|
|
| T |
23870526 |
t |
23870526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University