View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5446_low_38 (Length: 207)
Name: NF5446_low_38
Description: NF5446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5446_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 192
Target Start/End: Original strand, 1608422 - 1608594
Alignment:
| Q |
20 |
agataaactgtcaatgcaaagaacaggagaagtttaacatttttgcaacaaaatatcaaattttgcacagatatattctttctgacttcatcaaactcca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1608422 |
agataaactgtcaatgcaaagaacaggagaagtttaacttttttgcaacaaaatatcaaattttgcacagatatattctttctgacttcatcaaactcca |
1608521 |
T |
 |
| Q |
120 |
atcttgagtagtaaagaaaatacatttgtgacaaacatacatgtctaaatcaactaaaccacataagcccttt |
192 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1608522 |
attttgagtagtaaagaaaatacatttgtgacaaacatacatgcctaaatcaactaaaccacataagcccttt |
1608594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University