View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5448-Insertion-18 (Length: 154)
Name: NF5448-Insertion-18
Description: NF5448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5448-Insertion-18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 7e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 7e-69
Query Start/End: Original strand, 8 - 151
Target Start/End: Original strand, 43094975 - 43095118
Alignment:
| Q |
8 |
aaattttgaaatcaaatttgcagactaaattgcaatttctaacttctaacttagaattaattttaactcttcaaaatcacttttgactctactaaaattg |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43094975 |
aaatgttgaaatcaaatttgcagactaaattgaaatttctaacttctaacttagaattaattttaactcttcaaaatcacttttgactctactaaaattg |
43095074 |
T |
|
| Q |
108 |
aatccaaatacctactatttaacaatataatccttagtctttac |
151 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43095075 |
aatccaaatatctactatttaacaatataatccttagtctttac |
43095118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 66 - 113
Target Start/End: Complemental strand, 35728892 - 35728845
Alignment:
| Q |
66 |
aattttaactcttcaaaatcacttttgactctactaaaattgaatcca |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | |||| |||||||| |
|
|
| T |
35728892 |
aattttaattcttcaaaatcacttttgactcttccaaaagtgaatcca |
35728845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University