View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5448-Insertion-19 (Length: 175)
Name: NF5448-Insertion-19
Description: NF5448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5448-Insertion-19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 5e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 32 - 175
Target Start/End: Original strand, 46731830 - 46731973
Alignment:
| Q |
32 |
tgtgcatactgaatgataatagaaccaaaaaaggtacggatattttgccttatgtctttgattgtcatatatcacttctactggcagaggttgttatctt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46731830 |
tgtgcatactgaatgataatagaaccaaaaaaggtacggatattttgccttatgtctttgattgtcatatatcacttctactggcagaggttgttatctt |
46731929 |
T |
 |
| Q |
132 |
tgtgcactccaaaacaaatctgaccctctgccgtgccgtgctgt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46731930 |
tgtgcactccaaaacaaatctgaccctctgccgtgccgtgctgt |
46731973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University