View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5448-Insertion-21 (Length: 52)
Name: NF5448-Insertion-21
Description: NF5448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5448-Insertion-21 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 36; Significance: 0.000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 13 - 52
Target Start/End: Complemental strand, 41483014 - 41482975
Alignment:
| Q |
13 |
aatcagtagaaacgacaaagtacttacatgtttcctcttc |
52 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41483014 |
aatcagaagaaacgacaaagtacttacatgtttcctcttc |
41482975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University