View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5448-Insertion-8 (Length: 636)
Name: NF5448-Insertion-8
Description: NF5448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5448-Insertion-8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 1e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 7 - 122
Target Start/End: Original strand, 15631044 - 15631160
Alignment:
| Q |
7 |
atgccatagattgcacacgtaactagtttgataatatcaagtgctcgttagggtattcatctccaagccaccaaggacttttcccacccttgatcacgac |
106 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15631044 |
atgccatagattgcacacgtaactaatttgataatatcaagtgctcgttagggtattcatctccaagccaccaaggacttttcccacccttgatcacgac |
15631143 |
T |
 |
| Q |
107 |
-ttcgcatctccctcat |
122 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
15631144 |
tttggcatctccctcat |
15631160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University