View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5448_high_14 (Length: 347)
Name: NF5448_high_14
Description: NF5448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5448_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 17 - 329
Target Start/End: Original strand, 32531188 - 32531492
Alignment:
| Q |
17 |
acttatgagtaatttgattgagtcggatagaggattggaccgacccaaatcgatctaatttgattgagtcggataacgggttggaccaatttttgctgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32531188 |
acttatgagtaatttgattgagtcggatagcggattggaccaacccaaatcgatctaatttgattgagtcggataacgggttggaccaatttttgctaat |
32531287 |
T |
 |
| Q |
117 |
atcattatagctcattcttaacctctatttannnnnnnnnnnnnnatgctacagggaaatatagaagatcaattccatgctccaccagggtacagattcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32531288 |
atcattatagctcattcttaacctctattt--------tttttttatgctacagggaaatatagaagatcaattccatgctccaccagggtacagattcc |
32531379 |
T |
 |
| Q |
217 |
accagcaaagacaacatatgtacaacttcatcccaccagcagagacacaaaatggacaaacatccagaaatcagaatggtcatgaagttggagatactct |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||||||| |
|
|
| T |
32531380 |
accagcaaagacaacatatgtacaacttcatcccaccagcagagacacaaaatggacaaacatccagaactcagaatggtcatgaaatgggagatactct |
32531479 |
T |
 |
| Q |
317 |
ttatctcaatttg |
329 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
32531480 |
tgatctcaatttg |
32531492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University