View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5448_high_24 (Length: 260)

Name: NF5448_high_24
Description: NF5448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5448_high_24
NF5448_high_24
[»] chr3 (1 HSPs)
chr3 (18-251)||(44381289-44381522)


Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 44381289 - 44381522
Alignment:
18 tcttgctgggaaaggttggaccttttttaaaacgaaggaaaacccttctgtggatcactgtggtggaggtgttgtataccttttcaggaaggttgatgtg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44381289 tcttgctgggaaaggttggaccttttttaaaacgaaggaaaacccttctgtggatcactgtggtggaggtgttgtataccttttcaggaaggttgatgtg 44381388  T
118 aaccgggttcgagtgggtcgggttggagcacctgatggggcttgtagagtgagggaactgaggttgcctcatttggattttgaaaatgctcctttgagga 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
44381389 aaccgggttcgagtgggtcgggttggagcacctgatggggcttgtagagtgagggaactgaggttgcctcatttggattttgaaaatgctcctttgaaga 44381488  T
218 ttttgcagtatattttgttgatgactgatgatgt 251  Q
    ||||||||||||||||||||||||||||||||||    
44381489 ttttgcagtatattttgttgatgactgatgatgt 44381522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University