View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5448_high_33 (Length: 239)
Name: NF5448_high_33
Description: NF5448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5448_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 80 - 129
Target Start/End: Complemental strand, 12678254 - 12678205
Alignment:
| Q |
80 |
acaataatcatagtaaattgattacaaatatatagacgtgcatttgcaag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12678254 |
acaataatcatagtaaattgattacaaatatatagacgtgcatttgcaag |
12678205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 17 - 68
Target Start/End: Complemental strand, 12678289 - 12678238
Alignment:
| Q |
17 |
gtgaagaaaaacaacaccggacaaaagaatgcatgacaataatcatagtaaa |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12678289 |
gtgaagaaaaacaacaccggacaaaagaatgcataacaataatcatagtaaa |
12678238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University