View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5448_high_34 (Length: 239)
Name: NF5448_high_34
Description: NF5448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5448_high_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 8726383 - 8726585
Alignment:
| Q |
18 |
gagcaatggagaacatcatgaattttggaatcaggaggcaaggccagtttgtaagcaacctgtccaatccattccataatcaaataaggaccgtagaaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8726383 |
gagcaatggagaacatcatgaattttggaatgaggaggcaaggccagtttgtaagcaacctgtccaatccgttccataatcaaataaggaccgtagaaac |
8726482 |
T |
|
| Q |
118 |
gtttaacgatccgcaggtgctgccactaggcatgtgtttgttttaggaatttcaccattataagataggcaaattaagtttccagaattcacatggattt |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8726483 |
gtttaacgatccgtaggtgctgccactaggcatgtgtttgttttaggaatttcaccattataagataggcaaattaagttttcagaattcacatggattt |
8726582 |
T |
|
| Q |
218 |
gca |
220 |
Q |
| |
|
||| |
|
|
| T |
8726583 |
gca |
8726585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University